Gene:
TYMS
thymidylate synthetase

PharmGKB contains no dosing guidelines for this gene. To report known dosing guidelines, or if you are interested in developing guidelines, click here.

PharmGKB contains no drug labels with pharmacogenomic information for this gene. To report a drug label with PGx, click here.

PharmGKB contains no Clinical Variants that meet the highest level of criteria.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the table.

Position ? Drug ? Relevance ? Strength of
Evidence ?
rs2853539

To see relevance please register or sign in.

2
rs45445694

To see relevance please register or sign in.

3

Download a summary of all Clinical Annotations available.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

A non-comprehensive list of genetic tests for specific variants, including descriptions of and links to individual tests; manually curated by PharmGKB. The information listed is provided for educational purposes only and does not constitute an endorsement of any listed test or manufacturer.

PGx Test Variants Assayed Related Drugs?
TheraGuide 5-FU rs34743033
ARUP 5-Fluorouracil Sensitivity (DPYD, TYMS and MTHFR) 8 Mutations (2002420) rs16430
Myriad TheraGuide 5-FU (includes DNA sequencing of all 23 coding exons and approximately 690 adjacent intronic base pairs of the DPYD gene.) rs34743033, rs34743033

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Drugs" column lead to PharmGKB Drug Pages.

Variant?
(build 132)
Alternate Names ? Drugs ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available No Clinical Annotations available VA
rs2847153
G > A
Not Available
No VIP available CA VA
rs2853539 c.279+115A>G, g.649829A>G
A > G
Not Available
rs34489327 6-basepair 3'UTR repeat, TYMS:-TTAAAG, TYMS:1494del, TYMS:1494del TTAAAG, ttaaag
A > -
A > TTAAAG
Not Available
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
(CCGCGCCACTTCGCCTGCCTCCGTCCCG)2/3/4
Not Available
No VIP available CA VA
rs45445694 2, 28-bp tandem repeats located in the TS enhancer region of 5'UTR, TYMS:*2
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/3/4/7/8/9
Not Available
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP build 132

Overview

Alternate Names:  TYMS protein; Thymidylate synthase; thymidylate synthase
Alternate Symbols:  HST422; HsT422; MGC88736; TMS; TS; TSase; Tsase
PharmGKB Accession Id: PA359

Details

Cytogenetic Location: chr18 : p11.32 - p11.32
GP mRNA Boundary: chr18 : 657604 - 673499
GP Gene Boundary: chr18 : 647604 - 676499
Strand: plus
Product Name: No data available
The mRNA boundaries are calculated using the gene's default feature set from NCBI, mapped onto the UCSC Golden Path. PharmGKB sets gene boundaries by expanding the mRNA boundaries by no less than 10,000 bases upstream (5') and 3,000 bases downstream (3') to allow for potential regulatory regions.

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Antimetabolite Pathway - Folate Cycle, Pharmacodynamics
    Model non-tissue specific cancer cell displaying candidate genes which may be involved in the pharmacodynamics of antimetabolite drugs acting on the folate cycle.
  1. Fluoropyrimidine Pathway, Pharmacodynamics
    Model non-tissue-specific cancer cell displaying genes which may be involved in the pharmacodynamics of the fluoropyrimidines, 5-fluorouracil (5-FU), capecitabine and tegafur.
  1. Fluoropyrimidine Pathway, Pharmacokinetics
    Representation of the metabolic pathways for fluoropyrimidines.
  1. Methotrexate Pathway (Cancer Cell), Pharmacodynamics
    Methotrexate cellular disposition and effects.

External Pathways

Links to non-PharmGKB pathways.

  1. Pyrimidine biosynthesis (interconversion) - (Reactome via Pathway Interaction Database)
No related genes are available

Curated Information ?

Curated Information ?

Publications related to TYMS: 126

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic polymorphisms in key methotrexate pathway genes are associated with response to treatment in rheumatoid arthritis patients. The pharmacogenomics journal. 2012. Owen S A, et al. [Article:22450926@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Associations of various gene polymorphisms with toxicity in colorectal cancer patients receiving oral uracil and tegafur plus leucovorin: a prospective study. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2011. Tsunoda A, et al. [Article:20647221@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetic Tailoring of Irinotecan-based First-line Chemotherapy in Metastatic Colorectal Cancer: Results of a Pilot Study. Anticancer research. 2011. Freyer Gilles, et al. [Article:21273624@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methylenetetrahydrofolate reductase genetic polymorphisms and toxicity to 5-FU-based chemoradiation in rectal cancer. British journal of cancer. 2011. Thomas F, et al. [Article:22045187@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Mathematical modeling predicts the effect of folate deficiency and excess on cancer related biomarkers. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2011. Neuhouser Marian L, et al. [Article:21752986@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Gemcitabine and platinum pathway pharmacogenetics in Asian breast cancer patients. Cancer genomics & proteomics. 2011. Wong Andrea Li-Ann, et al. [Article:21980041@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic contribution to drug response. Cancer journal (Sudbury, Mass.). 2011. Watson Roshawn G, et al. [Article:21427551@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Associations between gene polymorphisms of thymidylate synthase with its protein expression and chemosensitivity to 5-fluorouracil in pancreatic carcinoma cells. Chinese medical journal. 2011. Zhang Qiang, et al. [Article:21362378@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A POLYMORPHISM IN THE CYTIDINE DEAMINASE PROMOTER PREDICTS SEVERE CAPECITABINE-INDUCED HAND-FOOT SYNDROME. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Caronia Daniela, et al. [Article:21325291@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
THYMIDYLATE SYNTHASE AND EXCISION REPAIR-CROSS-COMPLEMENTING GROUP-1 AS PREDICTORS OF RESPONSIVENESS IN MESOTHELIOMA PATIENTS TREATED WITH PEMETREXED-CARBOPLATIN. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Zucali Paolo Andrea, et al. [Article:21262916@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Positive interaction between lapatinib and capecitabine in human breast cancer models: study of molecular determinants. Fundamental & clinical pharmacology. 2011. Chefrour Mohamed, et al. [Article:21623901@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification of potential pharmacogenomic markers of clinical efficacy of 5-fluorouracil in colorectal cancer. International journal of cancer. Journal international du cancer. 2011. Nobili Stefania, et al. [Article:20560137@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thymidylate Synthase Genotype-Directed Neoadjuvant Chemoradiation for Patients With Rectal Adenocarcinoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Tan Benjamin R, et al. [Article:21205745@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic effects and modifiers of radiotherapy and chemotherapy on survival in pancreatic cancer. Pancreas. 2011. Zeng Hongmei, et al. [Article:21487324@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gender-specific genomic profiling in metastatic colorectal cancer patients treated with 5-fluorouracil and oxaliplatin. Pharmacogenomics. 2011. Gordon Michael A, et al. [Article:21174620@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Influence of polymorphisms in MTHFR 677 C¿T, TYMS 3R¿2R and MTR 2756 A¿G on NSCLC risk and response to platinum-based chemotherapy in advanced NSCLC. Pharmacogenomics. 2011. Cui Lian-Hua, et al. [Article:21605004@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of drug-induced birth defects: what is known so far?. Pharmacogenomics. 2011. Wilffert Bob, et al. [Article:21521026@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systems pharmacology assessment of the 5-fluorouracil pathway. Pharmacogenomics. 2011. Muhale Filipe A, et al. [Article:21449674@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The association of polymorphisms in 5-fluorouracil metabolism genes with outcome in adjuvant treatment of colorectal cancer. Pharmacogenomics. 2011. Afzal Shoaib, et al. [Article:21919605@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic tests in cancer chemotherapy: what physicians should know for clinical application. The Journal of pathology. 2011. Lee Soo-Youn, et al. [Article:20818641@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of thymidylate synthase enhancer region polymorphisms with thymidylate synthase activity in vivo. The pharmacogenomics journal. 2011. de Bock C E, et al. [Article:20531375@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methotrexate consolidation treatment according to pharmacogenetics of MTHFR ameliorates event-free survival in childhood acute lymphoblastic leukaemia. The pharmacogenomics journal. 2011. Salazar J, et al. [Article:21747412@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prediction of irinotecan and 5-fluorouracil toxicity and response in patients with advanced colorectal cancer. The pharmacogenomics journal. 2011. Glimelius B, et al. [Article:20177420@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TS and ERCC-1 mRNA expressions and clinical outcome in patients with metastatic colon cancer in CONFIRM-1 and -2 clinical trials. The pharmacogenomics journal. 2011. Grimminger P P, et al. [Article:21788964@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VEGF -460T ¿ C polymorphism and its association with VEGF expression and outcome to FOLFOX-4 treatment in patients with colorectal carcinoma. The pharmacogenomics journal. 2011. Chen M-H, et al. [Article:20531372@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Relationship between thymidylate synthase (TYMS) gene polymorphism and TYMS protein levels in patients with high-risk breast cancer. Anticancer research. 2010. Fujishima Makoto, et al. [Article:21036767@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Oxaliplatin, irinotecan and capecitabine as first-line therapy in metastatic colorectal cancer (mCRC): a dose-finding study and pharmacogenomic analysis. British journal of cancer. 2010. Zarate R, et al. [Article:20216541@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and FOLFOX response in colorectal cancer patients. British journal of clinical pharmacology. 2010. Etienne-Grimaldi Marie-Christine, et al. [Article:20078613@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Folate related gene polymorphisms and susceptibility to develop childhood acute lymphoblastic leukaemia. British journal of haematology. 2010. Koppen Ilan J N, et al. [Article:19775302@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Value of gene polymorphisms as markers of 5-FU therapy response in stage III colon carcinoma: a pilot study. Cancer chemotherapy and pharmacology. 2010. Fariña-Sarasqueta Arantza, et al. [Article:20665215@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Distribution of TYMS, MTHFR, p53 and MDR1 gene polymorphisms in patients with breast cancer treated with neoadjuvant chemotherapy. Cancer epidemiology. 2010. Henríquez-Hernández Luis Alberto, et al. [Article:20638924@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic polymorphisms associated with 5-Fluorouracil-induced neurotoxicity. Chemotherapy. 2010. Kim Suk-Ran, et al. [Article:20714149@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thymidylate Synthase Gene Polymorphism Affects the Response to Preoperative 5-Fluorouracil Chemoradiation Therapy in Patients With Rectal Cancer. International journal of radiation oncology, biology, physics. 2010. Hur Hyuk, et al. [Article:20932673@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients. International journal of radiation oncology, biology, physics. 2010. Lamas Maria J, et al. [Article:21167658@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thymidylate synthase germline polymorphisms in rectal cancer patients treated with neoadjuvant chemoradiotherapy based on 5-fluorouracil. Journal of cancer research and clinical oncology. 2010. Páez David, et al. [Article:20165956@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetic assessment of toxicity and outcome in patients with metastatic colorectal cancer treated with LV5FU2, FOLFOX, and FOLFIRI: FFCD 2000-05. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Boige Valérie, et al. [Article:20385995@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
PharmGKB summary: fluoropyrimidine pathways. Pharmacogenetics and genomics. 2010. Thorn Caroline F, et al. [Article:20601926@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphisms within the folate pathway predict folate concentrations but are not associated with disease activity in rheumatoid arthritis patients on methotrexate. Pharmacogenetics and genomics. 2010. Stamp Lisa K, et al. [Article:20386493@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Detection of the G>C SNP and rare mutations in the 28-bp repeat of TYMS using gel-based capillary electrophoresis. Pharmacogenomics. 2010. Thomas Fabienne, et al. [Article:21142919@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of psoriasis. Pharmacogenomics. 2010. O'Rielly Darren D, et al. [Article:21174624@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. [Article:21121811@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Variants in the dihydropyrimidine dehydrogenase, methylenetetrahydrofolate reductase and thymidylate synthase genes predict early toxicity of 5-fluorouracil in colorectal cancer patients. The Journal of international medical research. 2010. Kristensen M H, et al. [Article:20819423@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Changes in the gene expression profile of gastric cancer cells in response to ibuprofen: a gene pathway analysis. The pharmacogenomics journal. 2010. Bonelli P, et al. [Article:20548326@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor response is predicted by patient genetic profile in rectal cancer patients treated with neo-adjuvant chemo-radiotherapy. The pharmacogenomics journal. 2010. Cecchin E, et al. [Article:20368715@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leveraging learning from a phase III colorectal cancer clinical trial: outcomes, methodology, meta-analysis and pharmacogenetics. Transactions of the American Clinical and Climatological Association. 2010. Goldberg Richard M, et al. [Article:20697547@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic association study of putative functional single nucleotide polymorphisms of genes in folate metabolism and spina bifida. American journal of obstetrics and gynecology. 2009. Martinez Carla A, et al. [Article:19683694@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC). BMC cancer. 2009. Glaysher Sharon, et al. [Article:19712441@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
118 SNPs of folate-related genes and risks of spina bifida and conotruncal heart defects. BMC medical genetics. 2009. Shaw Gary M, et al. [Article:19493349@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Predictors of survival and toxicity in patients on adjuvant therapy with 5-fluorouracil for colorectal cancer. British journal of cancer. 2009. Gusella M, et al. [Article:19384296@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics of anticancer agents. CA: a cancer journal for clinicians. 2009. Huang R Stephanie, et al. [Article:19147868@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of folate-pathway gene polymorphisms with the risk of prostate cancer: a population-based nested case-control study, systematic review, and meta-analysis. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2009. Collin Simon M, et al. [Article:19706844@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Limits to thymidylate synthase and TP53 genes as predictive determinants for fluoropyrimidine sensitivity and further evidence for RNA-based toxicity as a major influence. Cancer research. 2009. Brody Jonathan R, et al. [Article:19155291@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Toxicity and efficacy of 5-fluorouracil and capecitabine in a patient with TYMS gene polymorphism: A challenge or a dilemma?. Clinical colorectal cancer. 2009. Shahrokni Armin, et al. [Article:19822515@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The increasing role of pharmacogenetics in the treatment of gastrointestinal cancers. Gastrointestinal cancer research : GCR. 2009. Yalçin Suayib. [Article:20084161@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of a phase III trial in metastatic gastroesophageal adenocarcinoma with fluorouracil and leucovorin plus either oxaliplatin or cisplatin: a study of the arbeitsgemeinschaft internistische onkologie. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Goekkurt Eray, et al. [Article:19332728@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Randomized phase II and pharmacogenetic study of pemetrexed compared with pemetrexed plus carboplatin in pretreated patients with advanced non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Smit Egbert F, et al. [Article:19307503@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of thymidylate synthase variants with 5-fluorouracil cytotoxicity. Pharmacogenetics and genomics. 2009. Peters Eric J, et al. [Article:19339911@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Evaluation of prognostic factors for the response to S-1 in patients with stage II or III advanced gastric cancer who underwent gastrectomy. Pharmacogenetics and genomics. 2009. Ishido Kenji, et al. [Article:19898266@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Purine biosynthetic pathway genes and methotrexate response in rheumatoid arthritis patients among north Indians. Pharmacogenetics and genomics. 2009. Sharma Shruti, et al. [Article:19902562@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Methotrexate in pediatric osteosarcoma: response and toxicity in relation to genetic polymorphisms and dihydrofolate reductase and reduced folate carrier 1 expression. The Journal of pediatrics. 2009. Patiño-García Ana, et al. [Article:19159907@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Investigation of inter-individual variability of the one-carbon folate pathway: a bioinformatic and genetic review. The pharmacogenomics journal. 2009. Carr D F, et al. [Article:19581920@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and biomarkers in colorectal cancer. The pharmacogenomics journal. 2009. Strimpakos A S, et al. [Article:19381163@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERCC2 2251A>C genetic polymorphism was highly correlated with early relapse in high-risk stage II and stage III colorectal cancer patients: a preliminary study. BMC cancer. 2008. Huang Ming-Yii, et al. [Article:18267032@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA variants in the dihydrofolate reductase gene and outcome in childhood ALL. Blood. 2008. Dulucq Stéphanie, et al. [Article:18096764@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thymidylate synthase and methylenetetrahydrofolate reductase gene polymorphisms and toxicity to capecitabine in advanced colorectal cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Sharma Rohini, et al. [Article:18245544@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pathway based analysis of SNPs with relevance to 5-FU therapy: relation to intratumoral mRNA expression and survival. International journal of cancer. Journal international du cancer. 2008. Nordgard Silje H, et al. [Article:18498133@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic analysis of 56 polymorphisms in 17 genes involved in methionine metabolism in patients with abdominal aortic aneurysm. Journal of medical genetics. 2008. Giusti B, et al. [Article:18635682@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphisms in folate-related genes: association with side effects of high-dose methotrexate in childhood acute lymphoblastic leukemia. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2008. Huang L, et al. [Article:18368069@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thymidylate synthase haplotype is associated with tumor recurrence in stage II and stage III colon cancer. Pharmacogenetics and genomics. 2008. Lurje Georg, et al. [Article:18192902@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictive Factors for Response and Toxicity in Chemotherapy: Pharmacogenomics. Seminars in colon & rectal surgery. 2008. Sanoff Hanna K, et al. [Article:19956343@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Common polymorphisms in the folate pathway predict efficacy of combination regimens containing methotrexate and sulfasalazine in early rheumatoid arthritis. The Journal of rheumatology. 2008. James Heather M, et al. [Article:18322994@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methotrexate (MTX) pathway gene polymorphisms and their effects on MTX toxicity in Caucasian and African American patients with rheumatoid arthritis. The Journal of rheumatology. 2008. Ranganathan Prabha, et al. [Article:18381794@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetic profiling in patients with advanced colorectal cancer treated with first-line FOLFIRI chemotherapy. The pharmacogenomics journal. 2008. Ruzzo A, et al. [Article:17549067@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The influence of fluorouracil outcome parameters on tolerance and efficacy in patients with advanced colorectal cancer. The pharmacogenomics journal. 2008. Capitain O, et al. [Article:17700593@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Transcription factor-binding sites in the thymidylate synthase gene: predictors of outcome in patients with metastatic colorectal cancer treated with 5-fluorouracil and oxaliplatin?. The pharmacogenomics journal. 2008. Paré L, et al. [Article:17684476@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic polymorphisms of folate metabolic enzymes and toxicities of high dose methotrexate in children with acute lymphoblastic leukemia. Annals of hematology. 2007. Pakakasama Samart, et al. [Article:17323057@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ancestry and pharmacogenetics of antileukemic drug toxicity. Blood. 2007. Kishi Shinji, et al. [Article:17264302@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Profile of polymorphisms of drug-metabolising enzymes and the risk of therapy-related leukaemia. British journal of haematology. 2007. Bolufer Pascual, et al. [Article:17367411@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genome-wide screening of loci associated with drug resistance to 5-fluorouracil-based drugs. Cancer science. 2007. Ooyama Akio, et al. [Article:17425594@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic profiling in patients with advanced colorectal cancer treated with first-line FOLFOX-4 chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Ruzzo Annamaria, et al. [Article:17401013@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphisms in the thymidylate synthase and dihydropyrimidine dehydrogenase genes predict response and toxicity to capecitabine-raltitrexed in colorectal cancer. Oncology reports. 2007. Salgado Josefa, et al. [Article:17203168@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
G>C SNP of thymidylate synthase with respect to colorectal cancer. Pharmacogenomics. 2007. Gusella Milena, et al. [Article:17716232@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic study of methylenetetrahydrofolate reductase and thymidylate synthase in Japanese and assessment of ethnic and gender differences. Pharmacogenomics. 2007. Inoue Sachie, et al. [Article:17187508@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphisms in folate, pyrimidine, and purine metabolism are associated with efficacy and toxicity of methotrexate in psoriasis. The Journal of investigative dermatology. 2007. Campalani Emanuela, et al. [Article:17410198@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thymidylate synthase (TYMS) and dihydropyrimidine dehydrogenase (DPYD) polymorphisms in the Korean population for prediction of 5-fluorouracil-associated toxicity. Therapeutic drug monitoring. 2007. Cho Hyun-Jung, et al. [Article:17417073@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methylenetetrahydrofolate reductase and thymidylate synthase genotypes and risk of acute graft-versus-host disease following hematopoietic cell transplantation for chronic myelogenous leukemia. Biology of blood and marrow transplantation : journal of the American Society for Blood and Marrow Transplantation. 2006. Robien Kim, et al. [Article:16920564@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The use of low dose methotrexate in rheumatoid arthritis - are we entering a new era of therapeutic drug monitoring and pharmacogenomics?. Biomedicine & pharmacotherapy = Biomédecine & pharmacothérapie. 2006. Stamp Lisa, et al. [Article:17071051@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Methylenetetrahydrofolate reductase and thymidylate synthase genotypes modify oral mucositis severity following hematopoietic stem cell transplantation. Bone marrow transplantation. 2006. Robien K, et al. [Article:16501586@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphisms of glutathione S-transferases (GST) and thymidylate synthase (TS)--novel predictors for response and survival in gastric cancer patients. British journal of cancer. 2006. Goekkurt E, et al. [Article:16317430@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Orotate phosphoribosyltransferase gene polymorphism predicts toxicity in patients treated with bolus 5-fluorouracil regimen. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Ichikawa Wataru, et al. [Article:16818689@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A novel G/C single-nucleotide polymorphism in the double 28-bp repeat thymidylate synthase allele. The pharmacogenomics journal. 2006. Gusella M, et al. [Article:16868573@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Effect of polymorphisms in folate-related genes on in vitro methotrexate sensitivity in pediatric acute lymphoblastic leukemia. Blood. 2005. de Jonge Robert, et al. [Article:15797993@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of outcome in children with acute lymphoblastic leukemia. Blood. 2005. Rocha Jose Claudio C, et al. [Article:15713801@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphic tandem repeat sequences of the thymidylate synthase gene correlates with cellular-based sensitivity to fluoropyrimidine antitumor agents. Cancer chemotherapy and pharmacology. 2005. Yawata Ayako, et al. [Article:15918040@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Relationships between promoter polymorphisms in the thymidylate synthase gene and mRNA levels in colorectal cancers. European journal of cancer (Oxford, England : 1990). 2005. Morganti Maria, et al. [Article:16182121@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphism discovery in 51 chemotherapy pathway genes. Human molecular genetics. 2005. Freimuth Robert R, et al. [Article:16239245@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Thymidylate synthase pharmacogenetics. Investigational new drugs. 2005. Marsh Sharon. [Article:16267625@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of extraordinary responses to 5-FU/cisplatin chemotherapy in advanced gastric cancer -- report of 2 cases. Onkologie. 2005. Wolschke Christine, et al. [Article:16249645@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Folate pathway gene expression differs in subtypes of acute lymphoblastic leukemia and influences methotrexate pharmacodynamics. The Journal of clinical investigation. 2005. Kager Leo, et al. [Article:15630450@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Combining several polymorphisms of thymidylate synthase gene for pharmacogenetic analysis. The pharmacogenomics journal. 2005. Krajinovic M, et al. [Article:16130010@PubMed]
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Polyglutamation of methotrexate with common polymorphisms in reduced folate carrier, aminoimidazole carboxamide ribonucleotide transformylase, and thymidylate synthase are associated with methotrexate effects in rheumatoid arthritis. Arthritis and rheumatism. 2004. Dervieux Thierry, et al. [Article:15457444@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A multivariate analysis of genomic polymorphisms: prediction of clinical outcome to 5-FU/oxaliplatin combination chemotherapy in refractory colorectal cancer. British journal of cancer. 2004. Stoehlmacher J, et al. [Article:15213713@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thymidylate synthase and methylenetetrahydrofolate reductase gene polymorphisms: relationships with 5-fluorouracil sensitivity. British journal of cancer. 2004. Etienne M-C, et al. [Article:14735204@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methionine synthase D919G polymorphism, folate metabolism, and colorectal adenoma risk. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2004. Goode Ellen L, et al. [Article:14744749@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Digital karyotyping identifies thymidylate synthase amplification as a mechanism of resistance to 5-fluorouracil in metastatic colorectal cancer patients. Proceedings of the National Academy of Sciences of the United States of America. 2004. Wang Tian-Li, et al. [Article:14970324@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification and analysis of single-nucleotide polymorphisms in the gemcitabine pharmacologic pathway. The pharmacogenomics journal. 2004. Fukunaga A K, et al. [Article:15224082@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Role of polymorphisms in MTHFR and MTHFD1 genes in the outcome of childhood acute lymphoblastic leukemia. The pharmacogenomics journal. 2004. Krajinovic M, et al. [Article:14647408@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A novel single nucleotide polymorphism within the 5' tandem repeat polymorphism of the thymidylate synthase gene abolishes USF-1 binding and alters transcriptional activity. Cancer research. 2003. Mandola Michael V, et al. [Article:12782596@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Identification and functional analysis of single nucleotide polymorphism in the tandem repeat sequence of thymidylate synthase gene. Cancer research. 2003. Kawakami Kazuyuki, et al. [Article:14522928@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The role of genetic factors in the development of hyperhomocysteinemia. Clinical chemistry and laboratory medicine : CCLM / FESCC. 2003. Geisel Jürgen, et al. [Article:14656021@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Associations between polymorphisms in the thymidylate synthase and serine hydroxymethyltransferase genes and susceptibility to malignant lymphoma. Haematologica. 2003. Hishida Asahi, et al. [Article:12604405@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thymidylate synthase gene polymorphism and its association with relapse in childhood B-cell precursor acute lymphoblastic leukemia. Haematologica. 2003. Lauten Melchior, et al. [Article:12651279@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer pharmacogenetics: polymorphisms, pathways and beyond. Nature reviews. Cancer. 2003. Ulrich Cornelia M, et al. [Article:14740638@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The influence of cyclin D1 (CCND1) 870A>G polymorphism and CCND1-thymidylate synthase (TS) gene-gene interaction on the outcome of childhood acute lymphoblastic leukaemia. Pharmacogenetics. 2003. Costea Irina, et al. [Article:12972956@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Novel aspects of resistance to drugs targeted to dihydrofolate reductase and thymidylate synthase. Biochimica et biophysica acta. 2002. Banerjee Debabrata, et al. [Article:12084458@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphisms in the thymidylate synthase and serine hydroxymethyltransferase genes and risk of adult acute lymphocytic leukemia. Blood. 2002. Skibola Christine F, et al. [Article:11986237@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thymidylate synthase: a novel genetic determinant of plasma homocysteine and folate levels. Human genetics. 2002. Trinh Binh N, et al. [Article:12215845@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphism of the thymidylate synthase gene and outcome of acute lymphoblastic leukaemia. Lancet. 2002. Krajinovic M, et al. [Article:11937185@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and folate metabolism -- a promising direction. Pharmacogenomics. 2002. Ulrich Cornelia M, et al. [Article:12052139@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphisms of the repeated sequences in the enhancer region of the thymidylate synthase gene promoter may predict downstaging after preoperative chemoradiation in rectal cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2001. Villafranca E, et al. [Article:11251009@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thymidylate synthase gene polymorphism determines response and toxicity of 5-FU chemotherapy. The pharmacogenomics journal. 2001. Pullarkat S T, et al. [Article:11913730@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphic tandem repeats in the thymidylate synthase gene is associated with its protein expression in human gastrointestinal cancers. Anticancer research. 1999. Kawakami K, et al. [Article:10652619@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of antimetabolites of purine and pyrimidine nucleotide metabolism in tumor cell differentiation. Biochemical pharmacology. 1999. Hatse S, et al. [Article:10413291@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Immunohistochemical quantitation of thymidylate synthase expression in colorectal cancer metastases predicts for clinical outcome to fluorouracil-based chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 1999. Aschele C, et al. [Article:10561213@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Quantitation of intratumoral thymidylate synthase expression predicts for resistance to protracted infusion of 5-fluorouracil and weekly leucovorin in disseminated colorectal cancers: preliminary report from an ongoing trial. European journal of cancer (Oxford, England : 1990). 1995. Leichman L, et al. [Article:7577041@PubMed]
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The role of thymidylate synthase expression in prognosis and outcome of adjuvant chemotherapy in patients with rectal cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 1994. Johnston P G, et al. [Article:7989939@PubMed]
PharmGKB® is a registered trademark of HHS and is financially supported by NIH/NIGMS. It is managed at Stanford University (R24 GM61374).
©2001-2012 PharmGKB.